Transcript: Human NR_048561.1

Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1E (PPM1E), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
PPM1E (22843)
Length:
6345
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_048561.1
NBCI Gene record:
PPM1E (22843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_048561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001910 GTCTCATTTACGCCACCACTA pLKO.1 1930 3UTR 100% 4.050 5.670 N PPM1E n/a
2 TRCN0000001908 CCCTCTAACTAATGGTATCTA pLKO.1 4704 3UTR 100% 5.625 4.500 N PPM1E n/a
3 TRCN0000273253 CCCTCTAACTAATGGTATCTA pLKO_005 4704 3UTR 100% 5.625 4.500 N PPM1E n/a
4 TRCN0000273254 GATCTTCCTTGGAGCTATAAA pLKO_005 2168 3UTR 100% 15.000 10.500 N PPM1E n/a
5 TRCN0000379844 GCTGAACATAAGCCATATATC pLKO_005 1145 3UTR 100% 13.200 9.240 N PPM1E n/a
6 TRCN0000273310 AGCTATTCCTGGGCGAGTTTC pLKO_005 176 3UTR 100% 10.800 7.560 N PPM1E n/a
7 TRCN0000001909 CCCAGGTTATGCTTGTGAGAA pLKO.1 978 3UTR 100% 4.950 3.465 N PPM1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_048561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11633 pDONR223 100% 31.5% None (many diffs) n/a
2 TRCN0000475566 CTAACCTAATGTCGGTTCTATATT pLX_317 13.1% 31.5% V5 (many diffs) n/a
Download CSV