Transcript: Human NR_049729.1

Homo sapiens ASB16 antisense RNA 1 (ASB16-AS1), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ASB16-AS1 (339201)
Length:
2275
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_049729.1
NBCI Gene record:
ASB16-AS1 (339201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_049729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168836 CAAGGTCTGGTTCTGAATCAT pLKO.1 1817 3UTR 100% 5.625 3.938 N ASB16-AS1 n/a
2 TRCN0000168786 GTGTCCTCCATGAGAATCATA pLKO.1 1606 3UTR 100% 5.625 3.938 N ASB16-AS1 n/a
3 TRCN0000168086 CAGTTGTCAGTTGTCTCCTTT pLKO.1 1839 3UTR 100% 4.950 3.465 N ASB16-AS1 n/a
4 TRCN0000445912 AGGTACAGAGCCACATGTTGC pLKO_005 1375 3UTR 100% 4.050 2.835 N ASB16-AS1 n/a
5 TRCN0000167067 CTACAGACAACAGAATTGGAA pLKO.1 1636 3UTR 100% 3.000 2.100 N ASB16-AS1 n/a
6 TRCN0000168638 GCTACAGACAACAGAATTGGA pLKO.1 1635 3UTR 100% 3.000 2.100 N ASB16-AS1 n/a
7 TRCN0000436986 TCTCAGCTTGAGGTCCTACCT pLKO_005 1584 3UTR 100% 2.640 1.848 N ASB16-AS1 n/a
8 TRCN0000417970 CTTAAGCCCAGGAGTGATTTG pLKO_005 1702 3UTR 100% 10.800 6.480 N ASB16-AS1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2117 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2117 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_049729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05449 pDONR223 100% 25.4% None 1_979del;1559_2275del n/a
2 ccsbBroad304_05449 pLX_304 0% 25.4% V5 1_979del;1559_2275del n/a
3 TRCN0000465985 GATCTTAATAGATGAAAAAGGGTT pLX_317 67.7% 25.4% V5 1_979del;1559_2275del n/a
Download CSV