Transcript: Human NR_072989.2

Homo sapiens monocyte to macrophage differentiation associated 2 (MMD2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MMD2 (221938)
Length:
1330
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_072989.2
NBCI Gene record:
MMD2 (221938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_072989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063193 CGACCGGATGGTCATCTATTT pLKO.1 488 3UTR 100% 13.200 18.480 N MMD2 n/a
2 TRCN0000063196 GCTTCTCTGCTACGTCGTAAT pLKO.1 779 3UTR 100% 10.800 15.120 N MMD2 n/a
3 TRCN0000063195 GAAGACGAAATACGCGAGGTT pLKO.1 200 3UTR 100% 2.640 3.696 N MMD2 n/a
4 TRCN0000429923 TGGCATCTCTTTGTAGCATTT pLKO_005 939 3UTR 100% 10.800 7.560 N MMD2 n/a
5 TRCN0000063197 CAGCCCACAGAGTATGAACAT pLKO.1 255 3UTR 100% 4.950 3.465 N MMD2 n/a
6 TRCN0000437450 CCCATGCTTTCTGGATCATCC pLKO_005 292 3UTR 100% 4.050 2.835 N MMD2 n/a
7 TRCN0000437139 TCTACTTCCTGTCGGACGATG pLKO_005 337 3UTR 100% 4.050 2.835 N MMD2 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1227 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1227 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_072989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14443 pDONR223 100% 54.4% None (many diffs) n/a
2 ccsbBroad304_14443 pLX_304 0% 54.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000479807 CACGACGGATGCCAAAATTATGAA pLX_317 46.7% 54.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV