Transcript: Human NR_072992.2

Homo sapiens enkurin, TRPC channel interacting protein (ENKUR), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ENKUR (219670)
Length:
1939
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_072992.2
NBCI Gene record:
ENKUR (219670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_072992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144939 GAACACGACATTGGCATAATT pLKO.1 934 3UTR 100% 15.000 21.000 N ENKUR n/a
2 TRCN0000143324 GATCATCCTGTCATGGGAATA pLKO.1 499 3UTR 100% 10.800 15.120 N ENKUR n/a
3 TRCN0000122373 CTAGAACACGACATTGGCATA pLKO.1 931 3UTR 100% 4.050 5.670 N ENKUR n/a
4 TRCN0000415852 TCCAGTCCCTCTCGGTCTTTA pLKO_005 854 3UTR 100% 13.200 10.560 N ENKUR n/a
5 TRCN0000122260 CGAAACGAGGAAATAAAGAAA pLKO.1 703 3UTR 100% 5.625 4.500 N ENKUR n/a
6 TRCN0000143973 CCCATGACATTTGCAGTTATT pLKO.1 1129 3UTR 100% 13.200 9.240 N ENKUR n/a
7 TRCN0000121712 CCAAGAAGACTATGATCGTTA pLKO.1 726 3UTR 100% 4.950 3.465 N ENKUR n/a
8 TRCN0000122699 GCAGCTAGTTTGACTTGGTTT pLKO.1 1429 3UTR 100% 4.950 3.465 N ENKUR n/a
9 TRCN0000144640 GAAACAACTAGAACACGACAT pLKO.1 924 3UTR 100% 4.050 2.835 N ENKUR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_072992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14436 pDONR223 100% 39.5% None 1_222del;975delT;991_1939del n/a
2 ccsbBroad304_14436 pLX_304 0% 39.5% V5 (not translated due to prior stop codon) 1_222del;975delT;991_1939del n/a
3 TRCN0000465697 CCCGGGGAGAGCGAACGCCGAATC pLX_317 49.3% 39.5% V5 (not translated due to prior stop codon) 1_222del;975delT;991_1939del n/a
Download CSV