Transcript: Human NR_073036.2

Homo sapiens orthodenticle homeobox 2 (OTX2), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
OTX2 (5015)
Length:
2759
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073036.2
NBCI Gene record:
OTX2 (5015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015612 CCATGACCTATACTCAGGCTT pLKO.1 586 3UTR 100% 2.640 3.696 N OTX2 n/a
2 TRCN0000176356 CCACTGATTGCTTGGATTATA pLKO.1 817 3UTR 100% 15.000 12.000 N Otx2 n/a
3 TRCN0000421657 GATCATTGGTTATCCTGATTT pLKO_005 1154 3UTR 100% 13.200 10.560 N OTX2 n/a
4 TRCN0000015611 GCTGGCTCAACTTCCTACTTT pLKO.1 627 3UTR 100% 5.625 4.500 N OTX2 n/a
5 TRCN0000175734 GCTGACTGCTTGGATTATAAA pLKO.1 873 3UTR 100% 15.000 10.500 N Otx2 n/a
6 TRCN0000015609 CCTCGTGGAAATTCCAGGTTT pLKO.1 904 3UTR 100% 4.950 3.465 N OTX2 n/a
7 TRCN0000015608 GCACTGAAACTTTACGACAAA pLKO.1 1693 3UTR 100% 4.950 3.465 N OTX2 n/a
8 TRCN0000419989 TAGCCAATCCTTGGTTGAATC pLKO_005 1303 3UTR 100% 10.800 6.480 N OTX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01128 pDONR223 100% 24.3% None 1_211del;307_308ins176;927_2759del n/a
2 ccsbBroad304_01128 pLX_304 0% 24.3% V5 1_211del;307_308ins176;927_2759del n/a
3 TRCN0000472658 TCCGCACGCTCGAAAAAACGTCGT pLX_317 51.2% 24.3% V5 1_211del;307_308ins176;927_2759del n/a
Download CSV