Transcript: Human NR_073079.2

Homo sapiens cornichon family AMPA receptor auxiliary protein 2 (CNIH2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CNIH2 (254263)
Length:
1370
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073079.2
NBCI Gene record:
CNIH2 (254263)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109844 GTACAGTATGGTTTATACGTT pLKO.1 728 3UTR 100% 3.000 4.200 N Cnih2 n/a
2 TRCN0000157247 CATGTATGATGCGGTCTCCAT pLKO.1 623 3UTR 100% 2.640 3.696 N CNIH2 n/a
3 TRCN0000157853 CAGAGCTTGACCCTGGAAATT pLKO.1 1084 3UTR 100% 13.200 9.240 N CNIH2 n/a
4 TRCN0000158206 CACCTTGTCTCTTGGACCTAT pLKO.1 1273 3UTR 100% 4.950 3.465 N CNIH2 n/a
5 TRCN0000153213 CTCCCTCATCTTCTTTGTCAT pLKO.1 336 3UTR 100% 4.950 3.465 N CNIH2 n/a
6 TRCN0000157380 CTGGTGCAAACTTGCCTTCTA pLKO.1 683 3UTR 100% 4.950 3.465 N CNIH2 n/a
7 TRCN0000153410 GCTCTCCTTCTTCTATTACCT pLKO.1 707 3UTR 100% 3.000 2.100 N CNIH2 n/a
8 TRCN0000158144 CTGATGTTTCTGTGTGCAGCA pLKO.1 516 3UTR 100% 2.160 1.512 N CNIH2 n/a
9 TRCN0000153620 CATTCTCAACTACTGCCAGAA pLKO.1 656 3UTR 100% 4.050 2.430 N CNIH2 n/a
10 TRCN0000109841 TCATGTATGATGCGGTCTCTA pLKO.1 622 3UTR 100% 4.950 6.930 N Cnih2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05299 pDONR223 100% 34.6% None 1_282del;359_360insGCAC;759_1370del n/a
2 ccsbBroad304_05299 pLX_304 0% 34.6% V5 1_282del;359_360insGCAC;759_1370del n/a
3 TRCN0000467503 CGCAGATAACCCTCGATAACGGCT pLX_317 71.6% 34.6% V5 1_282del;359_360insGCAC;759_1370del n/a
Download CSV