Transcript: Human NR_073096.2

Homo sapiens serine active site containing 1 (SERAC1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SERAC1 (84947)
Length:
1917
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073096.2
NBCI Gene record:
SERAC1 (84947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430019 ACAATACCAGAGGAATAATTT pLKO_005 1480 3UTR 100% 15.000 10.500 N SERAC1 n/a
2 TRCN0000412377 AGTTTACTGGATCACTTATTT pLKO_005 228 3UTR 100% 15.000 10.500 N SERAC1 n/a
3 TRCN0000151253 CCATTAAAGCAGATGTCCTTT pLKO.1 1182 3UTR 100% 4.950 3.465 N SERAC1 n/a
4 TRCN0000156152 CGAAGCGAAGAGAGTGATCTT pLKO.1 671 3UTR 100% 4.950 3.465 N SERAC1 n/a
5 TRCN0000151193 GCTGTGACATTAGATACTCAA pLKO.1 296 3UTR 100% 4.950 3.465 N SERAC1 n/a
6 TRCN0000152395 GCATGATTACCAGTATAGGAT pLKO.1 607 3UTR 100% 3.000 2.100 N SERAC1 n/a
7 TRCN0000177140 GAAGTCAAAGAACTCAGCAAA pLKO.1 1578 3UTR 100% 4.950 2.970 N Serac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09245 pDONR223 100% 74.2% None (many diffs) n/a
Download CSV