Transcript: Human NR_073470.2

Homo sapiens SPT4 homolog, DSIF elongation factor subunit (SUPT4H1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SUPT4H1 (6827)
Length:
1490
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073470.2
NBCI Gene record:
SUPT4H1 (6827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073470.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019645 GCAGCGAGTCAGTAACTTTAA pLKO.1 290 3UTR 100% 13.200 18.480 N SUPT4H1 n/a
2 TRCN0000280371 GCAGCGAGTCAGTAACTTTAA pLKO_005 290 3UTR 100% 13.200 18.480 N SUPT4H1 n/a
3 TRCN0000435570 GCAGCGAGTCAGTAACTTTAA pLKO_005 290 3UTR 100% 13.200 18.480 N Supt4a n/a
4 TRCN0000019646 AGATGGTATATGACTGCACTA pLKO.1 208 3UTR 100% 4.050 5.670 N SUPT4H1 n/a
5 TRCN0000019644 CCATTCTCTTAGGCACAGTAA pLKO.1 779 3UTR 100% 4.950 3.960 N SUPT4H1 n/a
6 TRCN0000280373 CCATTCTCTTAGGCACAGTAA pLKO_005 779 3UTR 100% 4.950 3.960 N SUPT4H1 n/a
7 TRCN0000417857 TCATTGCGATGATGAGTCCAG pLKO_005 247 3UTR 100% 2.160 1.728 N Supt4a n/a
8 TRCN0000081891 AGTGGCCTACAAATCCAGAGA pLKO.1 383 3UTR 100% 2.640 1.848 N Supt4a n/a
9 TRCN0000081958 CGATGATGAGTCCAGAGGACA pLKO.1 253 3UTR 100% 2.640 1.848 N Supt4b n/a
10 TRCN0000019648 TGATGGAATCATTGCGATGAT pLKO.1 239 3UTR 100% 0.495 0.347 N SUPT4H1 n/a
11 TRCN0000280374 TGATGGAATCATTGCGATGAT pLKO_005 239 3UTR 100% 0.495 0.347 N SUPT4H1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073470.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01623 pDONR223 100% 23.5% None 1_66del;136_137delGT;420_1490del n/a
2 ccsbBroad304_01623 pLX_304 0% 23.5% V5 1_66del;136_137delGT;420_1490del n/a
3 TRCN0000491489 ACTTACCTAAAGCCTCTCCGCCGC pLX_317 90% 23.5% V5 1_66del;136_137delGT;420_1490del n/a
Download CSV