Transcript: Human NR_074074.1

Homo sapiens NIN1 (RPN12) binding protein 1 homolog (NOB1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NOB1 (28987)
Length:
1644
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_074074.1
NBCI Gene record:
NOB1 (28987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_074074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135686 CCAAGGAAGTGCAATTGCATA pLKO.1 1375 3UTR 100% 4.950 3.465 N NOB1 n/a
2 TRCN0000280728 CCAAGGAAGTGCAATTGCATA pLKO_005 1375 3UTR 100% 4.950 3.465 N NOB1 n/a
3 TRCN0000136949 CCTGGAGCCAATCTTCAAGAA pLKO.1 1415 3UTR 100% 4.950 3.465 N NOB1 n/a
4 TRCN0000280803 CCTGGAGCCAATCTTCAAGAA pLKO_005 1415 3UTR 100% 4.950 3.465 N NOB1 n/a
5 TRCN0000167521 GAAAGGAATTTCCAAAGGATA pLKO.1 1433 3UTR 100% 4.950 3.465 N NOB1 n/a
6 TRCN0000166953 GCCAATCTTCAAGAAAGGAAT pLKO.1 1421 3UTR 100% 4.950 3.465 N NOB1 n/a
7 TRCN0000136318 CGGGAAGAACATTTACACCAT pLKO.1 127 3UTR 100% 2.640 1.848 N NOB1 n/a
8 TRCN0000280727 CGGGAAGAACATTTACACCAT pLKO_005 127 3UTR 100% 2.640 1.848 N NOB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_074074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03057 pDONR223 100% 62.2% None 1_58del;253_254ins131;1164_1644del n/a
2 ccsbBroad304_03057 pLX_304 0% 62.2% V5 1_58del;253_254ins131;1164_1644del n/a
3 TRCN0000466979 ACGCTGAGGCCAGTGTCCTACTAC pLX_317 12.1% 62.2% V5 1_58del;253_254ins131;1164_1644del n/a
Download CSV