Transcript: Human NR_102355.2

Homo sapiens glucosylceramidase beta 3 (gene/pseudogene) (GBA3), transcript variant 1, non-coding, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GBA3 (57733)
Length:
2135
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102355.2
NBCI Gene record:
GBA3 (57733)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_102355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417070 ATTCTCCAGGATGCGGAAATT pLKO_005 1055 3UTR 100% 13.200 18.480 N GBA3 n/a
2 TRCN0000413294 TATTATACAACTCGCTTAATC pLKO_005 1001 3UTR 100% 13.200 18.480 N GBA3 n/a
3 TRCN0000049592 CCCATATTCATCGATGGTGAT pLKO.1 848 3UTR 100% 4.050 5.670 N GBA3 n/a
4 TRCN0000049589 GCCATCACTTTCCATCTGGAT pLKO.1 815 3UTR 100% 2.640 3.696 N GBA3 n/a
5 TRCN0000416767 ATCAATGGATCTGTGATTAAA pLKO_005 1598 3UTR 100% 15.000 10.500 N GBA3 n/a
6 TRCN0000433946 TAATGCCTCGTGAAGTATTTA pLKO_005 1631 3UTR 100% 15.000 10.500 N GBA3 n/a
7 TRCN0000049590 GCACAGCTATGATTCCTTATT pLKO.1 694 3UTR 100% 13.200 9.240 N GBA3 n/a
8 TRCN0000049588 GCTGGGAGTATTTCAGACAAA pLKO.1 1245 3UTR 100% 4.950 3.465 N GBA3 n/a
9 TRCN0000049591 GACAGGTTTCATCAACCAGAA pLKO.1 343 3UTR 100% 4.050 2.835 N GBA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03849 pDONR223 100% 22.7% None (many diffs) n/a
2 ccsbBroad304_03849 pLX_304 0% 22.7% V5 (many diffs) n/a
3 TRCN0000478720 ACGTCCCGCTACGTATGTTGGGCA pLX_317 61.2% 22.7% V5 (many diffs) n/a
Download CSV