Transcript: Human NR_103556.2

Homo sapiens HYDIN axonemal central pair apparatus protein 2 (pseudogene) (HYDIN2), non-coding RNA.

Source:
NCBI, updated 2019-01-23
Taxon:
Homo sapiens (human)
Gene:
HYDIN2 (100288805)
Length:
10510
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103556.2
NBCI Gene record:
HYDIN2 (100288805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103556.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130761 GCTGCTATCAGGGTGACATTA pLKO.1 2970 3UTR 100% 13.200 6.600 Y HYDIN n/a
2 TRCN0000129902 GTACGAAACATTGGCAACAAA pLKO.1 1674 3UTR 100% 5.625 2.813 Y HYDIN n/a
3 TRCN0000129244 CCTGAATGACACACTGACATT pLKO.1 3623 3UTR 100% 4.950 2.475 Y HYDIN n/a
4 TRCN0000128459 GATACCCACTATTACCACTTT pLKO.1 3780 3UTR 100% 4.950 2.475 Y HYDIN n/a
5 TRCN0000128953 GCACATTGTTATGAGGCGATA pLKO.1 2439 3UTR 100% 4.050 2.025 Y HYDIN n/a
6 TRCN0000129853 GCAATTGATGTGATACTCGAA pLKO.1 4008 3UTR 100% 2.640 1.320 Y HYDIN n/a
7 TRCN0000130077 CGCAGTAATATCATTGCCCAT pLKO.1 1977 3UTR 100% 2.160 1.080 Y HYDIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103556.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12076 pDONR223 100% 18.4% None (many diffs) n/a
2 ccsbBroad304_12076 pLX_304 0% 18.4% V5 (many diffs) n/a
3 TRCN0000477734 AATGACCAAATATTACATGCCAAC pLX_317 14.5% 18.4% V5 (many diffs) n/a
Download CSV