Transcript: Human NR_104018.2

Homo sapiens peripheral myelin protein 22 (PMP22), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PMP22 (5376)
Length:
1616
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104018.2
NBCI Gene record:
PMP22 (5376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082804 CGGTGTCATCTATGTGATCTT pLKO.1 442 3UTR 100% 4.950 6.930 N PMP22 n/a
2 TRCN0000082807 GCGGTGTCATCTATGTGATCT pLKO.1 441 3UTR 100% 4.950 6.930 N PMP22 n/a
3 TRCN0000082806 CTCGGATTACTCCTACGGTTT pLKO.1 376 3UTR 100% 4.050 5.670 N PMP22 n/a
4 TRCN0000427823 TGAGGCTCTGAGCGTACATAG pLKO_005 498 3UTR 100% 10.800 7.560 N PMP22 n/a
5 TRCN0000303572 TGTCGATCATCTTCAGCATTC pLKO_005 207 3UTR 100% 6.000 4.200 N PMP22 n/a
6 TRCN0000082805 CCTGTTCTTCTGCCAACTCTT pLKO.1 238 3UTR 100% 4.950 3.465 N PMP22 n/a
7 TRCN0000333294 CCTGTTCTTCTGCCAACTCTT pLKO_005 238 3UTR 100% 4.950 3.465 N PMP22 n/a
8 TRCN0000303571 ATCACTGGAATCTTCCAAATT pLKO_005 287 3UTR 100% 13.200 7.920 N PMP22 n/a
9 TRCN0000082803 CCAAACTCAAACCAAACCAAA pLKO.1 576 3UTR 100% 4.950 2.970 N PMP22 n/a
10 TRCN0000315769 CCAAACTCAAACCAAACCAAA pLKO_005 576 3UTR 100% 4.950 2.970 N PMP22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01229 pDONR223 100% 23.6% None (many diffs) n/a
2 ccsbBroad304_01229 pLX_304 0% 23.6% V5 (many diffs) n/a
3 TRCN0000473943 CCCATGCGTATATCACGGGGATAC pLX_317 70.6% 23.6% V5 (many diffs) n/a
Download CSV