Transcript: Human NR_104102.1

Homo sapiens VPS29 retromer complex component (VPS29), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
VPS29 (51699)
Length:
1032
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104102.1
NBCI Gene record:
VPS29 (51699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304145 ATACCATCTTCTCTGTTAATA pLKO_005 648 3UTR 100% 15.000 10.500 N VPS29 n/a
2 TRCN0000111586 GCCTTGGAAACAAACATTATT pLKO.1 401 3UTR 100% 15.000 10.500 N Vps29 n/a
3 TRCN0000287955 GCCTTGGAAACAAACATTATT pLKO_005 401 3UTR 100% 15.000 10.500 N Vps29 n/a
4 TRCN0000304146 ACCTATGTGTATCAGCTAATT pLKO_005 464 3UTR 100% 13.200 9.240 N VPS29 n/a
5 TRCN0000304147 ATCCATGGACATCAAGTTATT pLKO_005 233 3UTR 100% 13.200 9.240 N VPS29 n/a
6 TRCN0000381463 CCCTGTTGCAGAGGCAATTTG pLKO_005 279 3UTR 100% 13.200 9.240 N VPS29 n/a
7 TRCN0000078596 CTTTGCACCAAAGAGAGTTAT pLKO.1 98 3UTR 100% 13.200 9.240 N VPS29 n/a
8 TRCN0000078593 GCTTCCTGTAAACTATAAGAA pLKO.1 683 3UTR 100% 5.625 3.938 N VPS29 n/a
9 TRCN0000078597 CCTTTGCACCAAAGAGAGTTA pLKO.1 97 3UTR 100% 4.950 3.465 N VPS29 n/a
10 TRCN0000300774 CCTTTGCACCAAAGAGAGTTA pLKO_005 97 3UTR 100% 4.950 3.465 N VPS29 n/a
11 TRCN0000379645 GAAAGTAGAACGAATCGAATA pLKO_005 496 3UTR 100% 10.800 6.480 N VPS29 n/a
12 TRCN0000078594 CCATCATTTGTGTTGATGGAT pLKO.1 422 3UTR 100% 0.300 0.180 N VPS29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03366 pDONR223 100% 42.6% None (many diffs) n/a
2 ccsbBroad304_03366 pLX_304 0% 42.6% V5 (many diffs) n/a
3 TRCN0000481468 CTACGTAAACCGGCCGTCGTGACC pLX_317 79.4% 42.6% V5 (many diffs) n/a
Download CSV