Transcript: Human NR_104317.1

Homo sapiens family with sequence similarity 234 member A (FAM234A), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
FAM234A (83986)
Length:
2552
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104317.1
NBCI Gene record:
FAM234A (83986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163460 GTTCGTCGTCTCATTCGTCAT pLKO.1 640 3UTR 100% 4.050 5.670 N FAM234A n/a
2 TRCN0000159494 CAGTTCTTTCATTGCAGTCAA pLKO.1 997 3UTR 100% 4.950 3.960 N FAM234A n/a
3 TRCN0000163738 GCGAATGTGGAGGATAGACTA pLKO.1 688 3UTR 100% 4.950 3.960 N FAM234A n/a
4 TRCN0000412603 TTCTGGCTGTGGATGATATAA pLKO_005 732 3UTR 100% 15.000 10.500 N FAM234A n/a
5 TRCN0000436816 ACTGGGAGAGCATGCTCAATG pLKO_005 1374 3UTR 100% 10.800 7.560 N FAM234A n/a
6 TRCN0000423748 CCTTGGCTGTAGCCGTTGAAA pLKO_005 1596 3UTR 100% 5.625 3.938 N FAM234A n/a
7 TRCN0000164619 CAGATCCTGTTTCTGGACCTT pLKO.1 1637 3UTR 100% 2.640 1.848 N FAM234A n/a
8 TRCN0000162308 CCAGTTCTTTCATTGCAGTCA pLKO.1 996 3UTR 100% 2.640 1.848 N FAM234A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09141 pDONR223 100% 61.5% None (many diffs) n/a
2 ccsbBroad304_09141 pLX_304 0% 61.5% V5 (many diffs) n/a
3 TRCN0000476580 ACACAAATACAAGTTTCCTGCATG pLX_317 12.2% 61.5% V5 (many diffs) n/a
Download CSV