Transcript: Mouse NR_104449.1

Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (Galnt9), transcript variant C, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Galnt9 (231605)
Length:
1598
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104449.1
NBCI Gene record:
Galnt9 (231605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419113 ACGTACGGAGAGGTGAGAAAC pLKO_005 410 3UTR 100% 10.800 7.560 N GALNT9 n/a
2 TRCN0000093882 GACTCCAAGTGTCTGGTAGAT pLKO.1 621 3UTR 100% 4.950 3.465 N Galnt9 n/a
3 TRCN0000093881 GATGTCTAAAGATGCCAACTT pLKO.1 770 3UTR 100% 4.950 3.465 N Galnt9 n/a
4 TRCN0000093880 GCAGAAGTGGATGATCCGAAA pLKO.1 824 3UTR 100% 4.050 2.835 N Galnt9 n/a
5 TRCN0000093883 CCCGACTCCAAGTGTCTGGTA pLKO.1 618 3UTR 100% 0.880 0.616 N Galnt9 n/a
6 TRCN0000093879 CCGCTTGTGTTCTGGTAACAA pLKO.1 1382 3UTR 100% 5.625 7.875 N Galnt9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08178 pDONR223 100% 38.4% None (many diffs) n/a
2 ccsbBroad304_08178 pLX_304 0% 38.4% V5 (many diffs) n/a
3 TRCN0000468976 AGTCTGCCGCCATTTATGGACTAC pLX_317 53.8% 38.4% V5 (many diffs) n/a
Download CSV