Transcript: Mouse NR_104576.1

Mus musculus striatin interacting protein 2 (Strip2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Mus musculus (mouse)
Gene:
Strip2 (320609)
Length:
5377
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104576.1
NBCI Gene record:
Strip2 (320609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104576.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215819 CATTGCAGATATACAGATAAA pLKO.1 1507 3UTR 100% 13.200 18.480 N Strip2 n/a
2 TRCN0000144412 CTACAATGAAAGGGATCTCTT pLKO.1 1163 3UTR 100% 4.950 6.930 N STRIP2 n/a
3 TRCN0000264787 TGTACTGGAAGTATCATATAT pLKO_005 4357 3UTR 100% 15.000 10.500 N Strip2 n/a
4 TRCN0000264785 TCTAAAGCAGCACAAGTATAT pLKO_005 1483 3UTR 100% 13.200 9.240 N Strip2 n/a
5 TRCN0000264786 CAGTAGGGAGAAACGGCTTAA pLKO_005 449 3UTR 100% 10.800 7.560 N Strip2 n/a
6 TRCN0000283172 CTGAGTGTCATGTACCTAATG pLKO_005 699 3UTR 100% 10.800 7.560 N Strip2 n/a
7 TRCN0000191890 GCACATTGAATGCTTCATCAT pLKO.1 3288 3UTR 100% 4.950 3.465 N Strip2 n/a
8 TRCN0000192120 CACACATAATGAAGAGCCGTT pLKO.1 806 3UTR 100% 2.160 1.512 N Strip2 n/a
9 TRCN0000215324 CTAAGACAGACTCTATCAATA pLKO.1 1686 3UTR 100% 13.200 7.920 N Strip2 n/a
10 TRCN0000264784 CTAAGACAGACTCTATCAATA pLKO_005 1686 3UTR 100% 13.200 7.920 N Strip2 n/a
11 TRCN0000144910 GCTAAGACAGACTCTATCAAT pLKO.1 1685 3UTR 100% 5.625 3.375 N STRIP2 n/a
12 TRCN0000121875 GACATCTACAATGAAAGGGAT pLKO.1 1158 3UTR 100% 2.640 1.584 N STRIP2 n/a
13 TRCN0000142736 CCAAGCAGAAGAATGTACCTT pLKO.1 2368 3UTR 100% 3.000 2.100 N STRIP2 n/a
14 TRCN0000142014 GATAACTGCTTGCAGAGCGTA pLKO.1 2459 3UTR 100% 2.640 1.848 N STRIP2 n/a
15 TRCN0000141806 GAGTTGGAAGAAGATGCCCAA pLKO.1 387 3UTR 100% 2.160 1.296 N STRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104576.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03824 pDONR223 100% 38% None (many diffs) n/a
2 ccsbBroad304_03824 pLX_304 0% 38% V5 (many diffs) n/a
Download CSV