Transcript: Human NR_109776.2

Homo sapiens Rho GTPase activating protein 6 (ARHGAP6), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ARHGAP6 (395)
Length:
5522
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_109776.2
NBCI Gene record:
ARHGAP6 (395)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_109776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380488 GCGAATGACAGGGCCTATAAA pLKO_005 2053 3UTR 100% 15.000 21.000 N ARHGAP6 n/a
2 TRCN0000379888 GCACCTTGCAGCTCCTCATAT pLKO_005 2693 3UTR 100% 13.200 9.240 N ARHGAP6 n/a
3 TRCN0000380269 TCACCGATCTTGATGACAATC pLKO_005 2288 3UTR 100% 10.800 7.560 N ARHGAP6 n/a
4 TRCN0000047160 CCATTCCCAAAGATGGACAAA pLKO.1 1925 3UTR 100% 4.950 3.465 N ARHGAP6 n/a
5 TRCN0000047159 GCCGATGACAACATCAGCAAA pLKO.1 2785 3UTR 100% 4.950 3.465 N ARHGAP6 n/a
6 TRCN0000047162 CGTCGTCAAAGTCAAGGGAAA pLKO.1 3407 3UTR 100% 4.050 2.835 N ARHGAP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_109776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05848 pDONR223 100% 52.8% None (many diffs) n/a
2 ccsbBroad304_05848 pLX_304 0% 52.8% V5 (many diffs) n/a
3 TRCN0000476350 CACCAACCGCACCCAGCTGTATTC pLX_317 11.4% 52.8% V5 (many diffs) n/a
Download CSV