Transcript: Human NR_110328.2

Homo sapiens major facilitator superfamily domain containing 1 (MFSD1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
MFSD1 (64747)
Length:
2245
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110328.2
NBCI Gene record:
MFSD1 (64747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344891 GGGCATAATGCTAGGGAATAT pLKO_005 1965 3UTR 100% 13.200 18.480 N MFSD1 n/a
2 TRCN0000344948 TATCTGTGGTCTTACTCTATT pLKO_005 1408 3UTR 100% 13.200 18.480 N MFSD1 n/a
3 TRCN0000059689 CCTCGGGATCACACTTATGAT pLKO.1 616 3UTR 100% 5.625 7.875 N MFSD1 n/a
4 TRCN0000059692 GTCTTACTCTATTTGGTGAAT pLKO.1 1416 3UTR 100% 4.950 6.930 N MFSD1 n/a
5 TRCN0000344892 ATCTTGGGTTGGCCATCATTT pLKO_005 1179 3UTR 100% 13.200 9.240 N MFSD1 n/a
6 TRCN0000059690 CCTTAGCAGTTGCCCAGAATA pLKO.1 441 3UTR 100% 13.200 9.240 N MFSD1 n/a
7 TRCN0000344890 GCCCTTCAGACTCAAGTTAAA pLKO_005 292 3UTR 100% 13.200 9.240 N MFSD1 n/a
8 TRCN0000059691 GTGGCATTTGTAGTTCCTGAA pLKO.1 1115 3UTR 100% 4.050 2.835 N MFSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14246 pDONR223 100% 54.2% None (many diffs) n/a
2 ccsbBroad304_14246 pLX_304 0% 54.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472389 CAAACTAGACCTTGCACTCTCTGA pLX_317 30.9% 54.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV