Transcript: Mouse NR_110776.1

Mus musculus coiled-coil domain containing 169 (Ccdc169), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2016-07-26
Taxon:
Mus musculus (mouse)
Gene:
Ccdc169 (320604)
Length:
2401
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110776.1
NBCI Gene record:
Ccdc169 (320604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_110776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264718 GTGGAATCTTTAAACGTATTA pLKO_005 365 3UTR 100% 13.200 18.480 N Ccdc169 n/a
2 TRCN0000264719 AGTGAAAGAATATGCGTTTAG pLKO_005 427 3UTR 100% 10.800 15.120 N Ccdc169 n/a
3 TRCN0000264720 CCGTTCCTACATCGCGGAAAT pLKO_005 493 3UTR 100% 10.800 15.120 N Ccdc169 n/a
4 TRCN0000190573 GCCAAGAAAGGACCAGTTAAA pLKO.1 767 3UTR 100% 13.200 9.240 N Ccdc169 n/a
5 TRCN0000264722 GCCAAGAAAGGACCAGTTAAA pLKO_005 767 3UTR 100% 13.200 9.240 N Ccdc169 n/a
6 TRCN0000216465 GTAGATAATAGAACCATAATG pLKO.1 1936 3UTR 100% 13.200 9.240 N Ccdc169 n/a
7 TRCN0000264721 GTAGATAATAGAACCATAATG pLKO_005 1936 3UTR 100% 13.200 9.240 N Ccdc169 n/a
8 TRCN0000201765 GCCAGTGGAATCTTTAAACGT pLKO.1 361 3UTR 100% 3.000 2.100 N Ccdc169 n/a
9 TRCN0000190750 GCCAAGTGAAAGAATATGCGT pLKO.1 423 3UTR 100% 0.750 0.525 N Ccdc169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.