Transcript: Human NR_111901.2

Homo sapiens TBC1 domain family member 20 (TBC1D20), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TBC1D20 (128637)
Length:
2026
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111901.2
NBCI Gene record:
TBC1D20 (128637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148575 CGTGCGGTTATATGACTTCTT pLKO.1 833 3UTR 100% 4.950 6.930 N TBC1D20 n/a
2 TRCN0000278258 CGTGCGGTTATATGACTTCTT pLKO_005 833 3UTR 100% 4.950 6.930 N TBC1D20 n/a
3 TRCN0000129790 CCTTCCTCTTACATCACATTA pLKO.1 1354 3UTR 100% 13.200 9.240 N TBC1D20 n/a
4 TRCN0000278257 CCTTCCTCTTACATCACATTA pLKO_005 1354 3UTR 100% 13.200 9.240 N TBC1D20 n/a
5 TRCN0000148772 CAATGGACAACACCAAGCATA pLKO.1 670 3UTR 100% 4.950 3.465 N TBC1D20 n/a
6 TRCN0000278256 CAATGGACAACACCAAGCATA pLKO_005 670 3UTR 100% 4.950 3.465 N TBC1D20 n/a
7 TRCN0000148910 CCATGACATTGTGGTCACATT pLKO.1 566 3UTR 100% 4.950 3.465 N TBC1D20 n/a
8 TRCN0000130793 GATTTACTTTGCAGCCGTGAT pLKO.1 878 3UTR 100% 4.050 2.835 N TBC1D20 n/a
9 TRCN0000297183 GATTTACTTTGCAGCCGTGAT pLKO_005 878 3UTR 100% 4.050 2.835 N TBC1D20 n/a
10 TRCN0000130894 GCTTTGTGAAATTGGCAGTGA pLKO.1 1225 3UTR 100% 2.640 1.848 N TBC1D20 n/a
11 TRCN0000318980 GCTTTGTGAAATTGGCAGTGA pLKO_005 1225 3UTR 100% 2.640 1.848 N TBC1D20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04845 pDONR223 100% 59.6% None 1_128del;1338_2026del n/a
2 ccsbBroad304_04845 pLX_304 0% 59.6% V5 1_128del;1338_2026del n/a
3 TRCN0000481369 CTCCCAGGGCAAACTATTAATGTC pLX_317 34.7% 59.6% V5 1_128del;1338_2026del n/a
Download CSV