Transcript: Human NR_111966.2

Homo sapiens spalt like transcription factor 2 (SALL2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
SALL2 (6297)
Length:
1756
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111966.2
NBCI Gene record:
SALL2 (6297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234697 TGCCAAGTGCTGCGCACAATT pLKO_005 308 3UTR 100% 13.200 18.480 N SALL2 n/a
2 TRCN0000153534 CCCAGGAGATATTTGGGAAAT pLKO.1 1083 3UTR 100% 10.800 7.560 N SALL2 n/a
3 TRCN0000155641 CAGTTAATCTCGGACTGCGAA pLKO.1 231 3UTR 100% 2.640 1.848 N SALL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11117 pDONR223 100% 31.9% None (many diffs) n/a
2 ccsbBroad304_11117 pLX_304 0% 31.9% V5 (many diffs) n/a
3 TRCN0000492012 TGATACCACTGCTATCCAACTCAA pLX_317 59.1% 31.9% V5 (many diffs) n/a
Download CSV