Transcript: Mouse NR_121195.1

Mus musculus tetraspanin 5 (Tspan5), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tspan5 (56224)
Length:
3104
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_121195.1
NBCI Gene record:
Tspan5 (56224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_121195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094994 GCAGATTTAGTTTGTGGGTTT pLKO.1 2563 3UTR 100% 4.050 5.670 N Tspan5 n/a
2 TRCN0000094998 AGTCAGTTGTTGCATCAAATA pLKO.1 402 3UTR 100% 13.200 10.560 N Tspan5 n/a
3 TRCN0000094996 GCATTGCATTGCTACAGATTT pLKO.1 1033 3UTR 100% 13.200 9.240 N Tspan5 n/a
4 TRCN0000218149 TAGACTTCACCCAGGAATATT pLKO_005 803 3UTR 100% 15.000 10.500 N TSPAN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_121195.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02314 pDONR223 100% 21.6% None (many diffs) n/a
2 ccsbBroad304_02314 pLX_304 0% 21.6% V5 (many diffs) n/a
3 TRCN0000468718 ACGTGCATACCCAGCACTGCTTTA pLX_317 41.7% 21.6% V5 (many diffs) n/a
Download CSV