Transcript: Mouse NR_121629.1

Mus musculus solute carrier family 6 (neurotransmitter transporter), member 17 (Slc6a17), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Slc6a17 (229706)
Length:
4403
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_121629.1
NBCI Gene record:
Slc6a17 (229706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_121629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079736 CCAGCCGTATCGATTCTATTT pLKO.1 1773 3UTR 100% 13.200 18.480 N Slc6a17 n/a
2 TRCN0000079734 CCTCTGGAAAGGTAATGTATT pLKO.1 830 3UTR 100% 13.200 9.240 N Slc6a17 n/a
3 TRCN0000079735 GCTACAACAAACAGGACAATA pLKO.1 1049 3UTR 100% 13.200 9.240 N Slc6a17 n/a
4 TRCN0000079737 GCCGTATCGATTCTATTTCTA pLKO.1 1776 3UTR 100% 5.625 3.938 N Slc6a17 n/a
5 TRCN0000038516 GTGGTCGAGAATGCTGAGAAA pLKO.1 1186 3UTR 100% 4.950 3.465 N SLC6A17 n/a
6 TRCN0000038518 CCTGGATTTATGGAACCAAGA pLKO.1 1718 3UTR 100% 4.050 2.835 N SLC6A17 n/a
7 TRCN0000038514 CGGAAACTACTTTGTCACCAT pLKO.1 1632 3UTR 100% 2.640 1.848 N SLC6A17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_121629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.