Transcript: Human NR_122080.1

Homo sapiens uncharacterized LOC439933 (LOC439933), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
LOC439933 (439933)
Length:
1318
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_122080.1
NBCI Gene record:
LOC439933 (439933)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_122080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073773 CCTCTCAAGTAGCTGGGACTA pLKO.1 239 3UTR 100% 4.050 2.025 Y TINAGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_122080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13684 pDONR223 100% 26.7% None 1_15del;58T>C;370_1318del n/a
2 ccsbBroad304_13684 pLX_304 0% 26.7% V5 1_15del;58T>C;370_1318del n/a
3 TRCN0000469160 GTTCCGTCCTGGCTCCTCCGTCGG pLX_317 80.4% 26.7% V5 1_15del;58T>C;370_1318del n/a
Download CSV