Transcript: Human NR_126532.2

Homo sapiens polycystin 1 like 2 (gene/pseudogene) (PKD1L2), transcript variant 1, non-coding, non-coding RNA.

Source:
NCBI, updated 2019-03-29
Taxon:
Homo sapiens (human)
Gene:
PKD1L2 (114780)
Length:
7651
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126532.2
NBCI Gene record:
PKD1L2 (114780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_126532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427828 ACGGATGCCGTGCACCATATT pLKO_005 6176 3UTR 100% 13.200 18.480 N PKD1L2 n/a
2 TRCN0000412990 ATGGACCGGAAGTGGTATTTC pLKO_005 4465 3UTR 100% 13.200 18.480 N PKD1L2 n/a
3 TRCN0000077971 GCCCGTGGATATAAAGATCAT pLKO.1 3354 3UTR 100% 4.950 6.930 N PKD1L2 n/a
4 TRCN0000077969 GCTTTATGATTGTCATCCTTA pLKO.1 6961 3UTR 100% 4.950 3.960 N PKD1L2 n/a
5 TRCN0000077968 GTCATAGCTTTCATGTCCATT pLKO.1 7490 3UTR 100% 4.950 3.960 N PKD1L2 n/a
6 TRCN0000432377 GCTATGTTCAGCTGGTATTTG pLKO_005 2101 3UTR 100% 13.200 9.240 N PKD1L2 n/a
7 TRCN0000077972 CCCATCAACCTCCTGATTGTT pLKO.1 4840 3UTR 100% 5.625 3.938 N PKD1L2 n/a
8 TRCN0000077970 GCAGCAGATGAGACCTACTTT pLKO.1 706 3UTR 100% 5.625 3.375 N PKD1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13035 pDONR223 100% 11.6% None (many diffs) n/a
2 ccsbBroad304_13035 pLX_304 0% 11.6% V5 (many diffs) n/a
3 TRCN0000475142 ACGCTTGATGGACTCACCCTGTCG pLX_317 52.1% 11.6% V5 (many diffs) n/a
Download CSV