Transcript: Human NR_130713.2

Homo sapiens sterile alpha motif domain containing 7 (SAMD7), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SAMD7 (344658)
Length:
2489
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130713.2
NBCI Gene record:
SAMD7 (344658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136034 GCATGTGGGAAGTATGTTCTA pLKO.1 1640 3UTR 100% 4.950 3.960 N SAMD7 n/a
2 TRCN0000133810 CCAAACCCTGAAAGAGATAAA pLKO.1 2169 3UTR 100% 13.200 9.240 N SAMD7 n/a
3 TRCN0000134330 GCAGAAGTACAGAACAGAAAT pLKO.1 2229 3UTR 100% 13.200 9.240 N SAMD7 n/a
4 TRCN0000136212 GAACACATGCACTGGTTACAA pLKO.1 1399 3UTR 100% 5.625 3.938 N SAMD7 n/a
5 TRCN0000136387 CCTCTGTTCTACCAAACACAA pLKO.1 521 3UTR 100% 4.950 3.465 N SAMD7 n/a
6 TRCN0000135927 GTTCAGACTATGCTCAGGTAT pLKO.1 1504 3UTR 100% 4.950 3.465 N SAMD7 n/a
7 TRCN0000135097 CCAGAAGTCAAGTGAAACGAA pLKO.1 1181 3UTR 100% 3.000 2.100 N SAMD7 n/a
8 TRCN0000134301 GCCTAGGATATTACAAAGGAT pLKO.1 1865 3UTR 100% 3.000 2.100 N SAMD7 n/a
9 TRCN0000135798 CCCTGAAAGAGATAAAGGCAA pLKO.1 2174 3UTR 100% 2.640 1.848 N SAMD7 n/a
10 TRCN0000138452 CCTTCCAGGTTGTTCAGACTA pLKO.1 1493 3UTR 100% 4.950 2.970 N SAMD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05492 pDONR223 100% 53.7% None 1_366del;655_767del;1818_2489del n/a
2 ccsbBroad304_05492 pLX_304 0% 53.7% V5 1_366del;655_767del;1818_2489del n/a
3 TRCN0000480066 ACAATAGCCGTTCCTCAGTGTTCG pLX_317 28.6% 53.7% V5 1_366del;655_767del;1818_2489del n/a
Download CSV