Transcript: Human NR_130925.1

Homo sapiens uncharacterized LOC613266 (LOC613266), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
LOC613266 (613266)
Length:
2028
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130925.1
NBCI Gene record:
LOC613266 (613266)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130925.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183852 CGCTGAATCTTAATTGCAGTT pLKO.1 1537 3UTR 100% 4.050 5.670 N LOC613266 n/a
2 TRCN0000178841 CAACCTGACACCATCAGTATT pLKO.1 556 3UTR 100% 13.200 9.240 N LOC613266 n/a
3 TRCN0000179220 GCCCATTTCTCTCACCTTTAT pLKO.1 491 3UTR 100% 13.200 9.240 N LOC613266 n/a
4 TRCN0000181197 CTTGGCATCTTCTTCCCTCAA pLKO.1 531 3UTR 100% 4.050 2.025 Y LOC613266 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130925.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10653 pDONR223 100% 18.3% None 1_348del;721_2028del n/a
2 TRCN0000477194 ACTTCCTGGCCCAATTGGAAAAGG pLX_317 98.4% 18.3% V5 1_348del;721_2028del n/a
Download CSV