Transcript: Mouse NR_131029.1

Mus musculus centromere protein L (Cenpl), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2015-03-08
Taxon:
Mus musculus (mouse)
Gene:
Cenpl (70454)
Length:
2370
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131029.1
NBCI Gene record:
Cenpl (70454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_131029.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412316 CTGTGTCATAAATACCTTATT pLKO_005 1606 3UTR 100% 13.200 18.480 N CENPL n/a
2 TRCN0000184777 CAAAGGGACCATGAAGCGTTT pLKO.1 887 3UTR 100% 4.050 5.670 N Cenpl n/a
3 TRCN0000415780 ACTTCAACATCAAAGTGATTT pLKO_005 837 3UTR 100% 13.200 9.240 N CENPL n/a
4 TRCN0000179867 CGGAGTCCAATACATCTTTAA pLKO.1 1205 3UTR 100% 13.200 9.240 N Cenpl n/a
5 TRCN0000183236 GACTTATTTATGAACTGCCTT pLKO.1 1480 3UTR 100% 2.640 1.848 N Cenpl n/a
6 TRCN0000433972 TTCAGTCCTTTAGCAATCAAT pLKO_005 1261 3UTR 100% 5.625 3.938 N CENPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131029.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04555 pDONR223 100% 35.2% None (many diffs) n/a
2 ccsbBroad304_04555 pLX_304 0% 35.2% V5 (many diffs) n/a
3 TRCN0000480952 ACACTGTAATCGTGCTCTATTGGG pLX_317 36.6% 35.2% V5 (many diffs) n/a
Download CSV