Transcript: Mouse NR_131953.1

Mus musculus zinc finger protein 950 (Zfp950), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2015-10-26
Taxon:
Mus musculus (mouse)
Gene:
Zfp950 (414758)
Length:
1249
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131953.1
NBCI Gene record:
Zfp950 (414758)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_131953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095228 AGTGGGCTTTGCTGGATCATT pLKO.1 183 3UTR 100% 5.625 3.375 N Zfp950 n/a
2 TRCN0000095225 CCTGACTGCTATAGGCTACAA pLKO.1 250 3UTR 100% 4.950 2.970 N Zfp950 n/a
3 TRCN0000095227 GACGACCATAATATTGAAGAA pLKO.1 275 3UTR 100% 4.950 2.970 N Zfp950 n/a
4 TRCN0000243741 ACTCAGGAAGAGTGGGCTTTG pLKO_005 173 3UTR 100% 6.000 3.000 Y Gm14411 n/a
5 TRCN0000095226 CATGTGAACTTCACTCAGGAA pLKO.1 161 3UTR 100% 2.640 1.320 Y Zfp950 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.