Transcript: Human NR_132980.1

Homo sapiens small nucleolar RNA, C/D box 141A (SNORD141A), small nucleolar RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
SNORD141A (106635683)
Length:
105
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132980.1
NBCI Gene record:
SNORD141A (106635683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_132980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00480 pDONR223 100% 7.5% None 0_1ins944;105_106ins337 n/a
2 ccsbBroad304_00480 pLX_304 0% 7.5% V5 0_1ins944;105_106ins337 n/a
3 TRCN0000473284 CCCACAGCTCCTCCTCATCCGGAG pLX_317 40.1% 7.5% V5 0_1ins944;105_106ins337 n/a
Download CSV