Transcript: Mouse NR_133573.1

Mus musculus eva-1 homolog C (C. elegans) (Eva1c), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2015-12-25
Taxon:
Mus musculus (mouse)
Gene:
Eva1c (70967)
Length:
2169
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_133573.1
NBCI Gene record:
Eva1c (70967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_133573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267210 TCCGGCTGTTGCTAATCTAAA pLKO_005 1024 3UTR 100% 13.200 18.480 N Eva1c n/a
2 TRCN0000267209 GATGAACACGGTATAACATTC pLKO_005 1064 3UTR 100% 10.800 7.560 N Eva1c n/a
3 TRCN0000267208 TTGCTAATCTAAATCCTTCTC pLKO_005 1032 3UTR 100% 4.050 2.835 N Eva1c n/a
4 TRCN0000180141 CGCATGTGTTCCCAAGAACAT pLKO.1 988 3UTR 100% 0.495 0.347 N EVA1C n/a
5 TRCN0000420511 TTGTCCAGGAAGCAGTAAATA pLKO_005 649 3UTR 100% 15.000 9.000 N EVA1C n/a
6 TRCN0000267211 TCTGAAGAAAGATGATGAACA pLKO_005 1051 3UTR 100% 4.950 2.970 N Eva1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_133573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12422 pDONR223 100% 40% None (many diffs) n/a
2 ccsbBroad304_12422 pLX_304 0% 40% V5 (many diffs) n/a
3 TRCN0000465946 ATGACGTAGCCCATCTAACAAATT pLX_317 27.2% 40% V5 (many diffs) n/a
Download CSV