Transcript: Human NR_133915.3

Homo sapiens mediator complex subunit 29 (MED29), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MED29 (55588)
Length:
3531
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_133915.3
NBCI Gene record:
MED29 (55588)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_133915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422801 CCTAGCCTAGGGTAGACTTTG pLKO_005 789 3UTR 100% 10.800 15.120 N MED29 n/a
2 TRCN0000005459 GCAGCGTTATAAGATGCTCAT pLKO.1 216 3UTR 100% 4.050 5.670 N MED29 n/a
3 TRCN0000010940 ACAGAGTTGTGACAGTGCCAA pLKO.1 370 3UTR 100% 2.640 3.696 N MED29 n/a
4 TRCN0000005458 CGGTCATCAAAGCCCAGATTT pLKO.1 471 3UTR 100% 13.200 9.240 N MED29 n/a
5 TRCN0000005457 GCCTGTATTTGTGGAGCTGAT pLKO.1 2877 3UTR 100% 4.050 2.835 N MED29 n/a
6 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 2162 3UTR 100% 4.950 2.475 Y GJD4 n/a
7 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 2162 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_133915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12227 pDONR223 100% 15% None 1_45del;261_262ins59;587_3531del n/a
2 ccsbBroad304_12227 pLX_304 0% 15% V5 1_45del;261_262ins59;587_3531del n/a
Download CSV