Transcript: Human NR_134284.1

Homo sapiens zinc finger protein 517 (ZNF517), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
ZNF517 (340385)
Length:
2744
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134284.1
NBCI Gene record:
ZNF517 (340385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107753 GCTGATCCACACTGAGGAGAA pLKO.1 779 3UTR 100% 4.050 2.835 N ZNF517 n/a
2 TRCN0000107751 GCTGCTTCTCAGGCACCAGAT pLKO.1 677 3UTR 100% 1.350 0.810 N ZNF517 n/a
3 TRCN0000107754 GCGCCTACACACGGGCGAGAA pLKO.1 1268 3UTR 100% 0.000 0.000 N ZNF517 n/a
4 TRCN0000107752 GCACCAGAAGATCCACACCAA pLKO.1 1346 3UTR 100% 2.640 1.320 Y ZNF517 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10026 pDONR223 100% 53.7% None (many diffs) n/a
2 ccsbBroad304_10026 pLX_304 0% 53.7% V5 (many diffs) n/a
3 TRCN0000480463 CCTCAACATTAAGACCTAACATTC pLX_317 28.2% 53.7% V5 (many diffs) n/a
Download CSV