Transcript: Human NR_134475.2

Homo sapiens NADH:ubiquinone oxidoreductase subunit S4 (NDUFS4), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NDUFS4 (4724)
Length:
793
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134475.2
NBCI Gene record:
NDUFS4 (4724)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036630 CGCAATAACATGCAGTCTGGA pLKO.1 398 3UTR 100% 2.640 3.696 N NDUFS4 n/a
2 TRCN0000041847 GCTCGCAATAACATGCAGTCT pLKO.1 395 3UTR 100% 2.640 3.696 N Ndufs4 n/a
3 TRCN0000344753 TCAAGACACACAACTCATAAC pLKO_005 289 3UTR 100% 10.800 8.640 N NDUFS4 n/a
4 TRCN0000344754 GAGTTCCAGAAGAGCATATAA pLKO_005 345 3UTR 100% 15.000 10.500 N NDUFS4 n/a
5 TRCN0000344752 TTTGTTCCTGCTCGCAATAAC pLKO_005 386 3UTR 100% 13.200 9.240 N NDUFS4 n/a
6 TRCN0000036631 CAAGTCTTATGGTGCAAACTT pLKO.1 619 3UTR 100% 5.625 3.938 N NDUFS4 n/a
7 TRCN0000036629 CCCTTATCCAACATGGTTCTA pLKO.1 506 3UTR 100% 4.950 3.465 N NDUFS4 n/a
8 TRCN0000333325 CCCTTATCCAACATGGTTCTA pLKO_005 506 3UTR 100% 4.950 3.465 N NDUFS4 n/a
9 TRCN0000036633 CAACTCATAACAGTTGATGAA pLKO.1 299 3UTR 100% 0.495 0.347 N NDUFS4 n/a
10 TRCN0000036632 GAGGACTTCCACATGGAGATT pLKO.1 253 3UTR 100% 4.950 2.970 N NDUFS4 n/a
11 TRCN0000333324 GAGGACTTCCACATGGAGATT pLKO_005 253 3UTR 100% 4.950 2.970 N NDUFS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06625 pDONR223 100% 65.6% None (many diffs) n/a
2 ccsbBroad304_06625 pLX_304 0% 65.6% V5 (many diffs) n/a
Download CSV