Transcript: Human NR_134525.2

Homo sapiens transcription termination factor 1 (TTF1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TTF1 (7270)
Length:
3136
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134525.2
NBCI Gene record:
TTF1 (7270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275586 GTGAAGACCTGTCACTATTAA pLKO_005 2803 3UTR 100% 15.000 21.000 N TTF1 n/a
2 TRCN0000022194 GCGTATCTACTATGGCATGAA pLKO.1 2310 3UTR 100% 4.950 6.930 N TTF1 n/a
3 TRCN0000022197 CCAGAGATCATCGACTACCTT pLKO.1 2512 3UTR 100% 3.000 4.200 N TTF1 n/a
4 TRCN0000275583 CCAGAGATCATCGACTACCTT pLKO_005 2512 3UTR 100% 3.000 4.200 N TTF1 n/a
5 TRCN0000275520 GCACAAGGTGTCGCTATTAAA pLKO_005 1643 3UTR 100% 15.000 10.500 N TTF1 n/a
6 TRCN0000275518 AGTCCAGTAACCGGGAATATG pLKO_005 732 3UTR 100% 13.200 9.240 N TTF1 n/a
7 TRCN0000022198 CCCTGGAAACTTATATACTAT pLKO.1 1853 3UTR 100% 5.625 3.938 N TTF1 n/a
8 TRCN0000022196 GCCAAGGTTAGAACCTGCAAA pLKO.1 1420 3UTR 100% 4.950 3.465 N TTF1 n/a
9 TRCN0000275519 GCCAAGGTTAGAACCTGCAAA pLKO_005 1420 3UTR 100% 4.950 3.465 N TTF1 n/a
10 TRCN0000022195 CCTCAGAAACATTCCCACGAA pLKO.1 143 3UTR 100% 2.640 1.848 N TTF1 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2887 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2789 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.