Transcript: Human NR_134539.2

Homo sapiens actin like 6B (ACTL6B), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-13
Taxon:
Homo sapiens (human)
Gene:
ACTL6B (51412)
Length:
1541
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134539.2
NBCI Gene record:
ACTL6B (51412)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116768 ACAGGCTCAATCGAGAGCTTT pLKO.1 1170 3UTR 100% 4.950 6.930 N ACTL6B n/a
2 TRCN0000090287 AGCATCGGCATGTGTGACATT pLKO.1 1079 3UTR 100% 4.950 6.930 N Actl6b n/a
3 TRCN0000116771 CACCTACAGCAAACACGTCAA pLKO.1 400 3UTR 100% 4.050 5.670 N ACTL6B n/a
4 TRCN0000116770 CAATGGCTACAATACAGACTA pLKO.1 955 3UTR 100% 4.950 3.465 N ACTL6B n/a
5 TRCN0000116767 CCTGGCATAACTACATGTGTA pLKO.1 831 3UTR 100% 4.950 3.465 N ACTL6B n/a
6 TRCN0000090286 CTGGCATAACTACATGTGTAA pLKO.1 832 3UTR 100% 4.950 3.465 N Actl6b n/a
7 TRCN0000116769 CCATTGACATCATCCCACCTT pLKO.1 726 3UTR 100% 2.640 1.848 N ACTL6B n/a
8 TRCN0000090283 GCAGTACAACATTCCTGCCTT pLKO.1 511 3UTR 100% 2.640 1.848 N Actl6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134539.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03302 pDONR223 100% 82.9% None 1_94del;1207_1223del;1390_1541del n/a
2 ccsbBroad304_03302 pLX_304 0% 82.9% V5 1_94del;1207_1223del;1390_1541del n/a
3 TRCN0000478329 ATCGTGTAATAAACAACTTGGTCA pLX_317 25.4% 82.9% V5 1_94del;1207_1223del;1390_1541del n/a
Download CSV