Transcript: Human NR_134580.2

Homo sapiens bestrophin 1 (BEST1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
BEST1 (7439)
Length:
2413
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134580.2
NBCI Gene record:
BEST1 (7439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435937 TGGATTGTCGACAGGAATTTG pLKO_005 1241 3UTR 100% 13.200 18.480 N BEST1 n/a
2 TRCN0000118744 GCTGCTATATGGCGAGTTCTT pLKO.1 203 3UTR 100% 4.950 6.930 N BEST1 n/a
3 TRCN0000121677 GCCTGAATCAAATGGTTAGCT pLKO.1 2192 3UTR 100% 3.000 4.200 N BEST1 n/a
4 TRCN0000118745 GTGGAGTTTAACCTGACGGAT pLKO.1 1925 3UTR 100% 2.640 3.696 N BEST1 n/a
5 TRCN0000419882 ATGCTCACGCTGGCATCATTG pLKO_005 1467 3UTR 100% 10.800 8.640 N BEST1 n/a
6 TRCN0000421544 GCCTACGACTGGATTAGTATC pLKO_005 789 3UTR 100% 10.800 8.640 N BEST1 n/a
7 TRCN0000118742 ACAGCCTGAATCAAATGGTTA pLKO.1 2189 3UTR 100% 4.950 3.960 N BEST1 n/a
8 TRCN0000122830 GACTCTGTATTGCGACAGCTA pLKO.1 308 3UTR 100% 2.640 2.112 N BEST1 n/a
9 TRCN0000118743 GCCGGACATGTACTGGAATAA pLKO.1 1315 3UTR 100% 13.200 9.240 N BEST1 n/a
10 TRCN0000118746 GAACACAAGCAGTTGGAGAAA pLKO.1 612 3UTR 100% 4.950 3.465 N BEST1 n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1146 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11219 pDONR223 100% 61.8% None (many diffs) n/a
2 ccsbBroad304_11219 pLX_304 0% 61.8% V5 (many diffs) n/a
3 TRCN0000479644 AATGTTTAAATGAGGAGGAAAATG pLX_317 23.2% 61.8% V5 (many diffs) n/a
Download CSV