Transcript: Human NR_134636.2

Homo sapiens nucleoporin 160 (NUP160), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
NUP160 (23279)
Length:
5278
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134636.2
NBCI Gene record:
NUP160 (23279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060113 CGTGTGATAATCTTGATGTTA pLKO.1 378 3UTR 100% 5.625 7.875 N NUP160 n/a
2 TRCN0000060117 CCGGATGTATAGGAGTGAGTT pLKO.1 440 3UTR 100% 4.950 6.930 N NUP160 n/a
3 TRCN0000060114 CCTCAGACTATTGTGGAGTTA pLKO.1 2400 3UTR 100% 4.950 6.930 N NUP160 n/a
4 TRCN0000060115 CGTCCAGAATATGCGTGGATT pLKO.1 3351 3UTR 100% 4.950 3.960 N NUP160 n/a
5 TRCN0000175203 CCCTATGTGAATCTGCATAAT pLKO.1 3105 3UTR 100% 13.200 9.240 N Nup160 n/a
6 TRCN0000352524 CCCTATGTGAATCTGCATAAT pLKO_005 3105 3UTR 100% 13.200 9.240 N Nup160 n/a
7 TRCN0000060116 CCTCATCCTTAGTGGATCATT pLKO.1 1639 3UTR 100% 5.625 3.938 N NUP160 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15755 pDONR223 0% 9.9% None (many diffs) n/a
2 ccsbBroad304_15755 pLX_304 0% 9.9% V5 (many diffs) n/a
3 TRCN0000474658 AAGTCGACTAGTTTGACGTGATTG pLX_317 78.1% 9.9% V5 (many diffs) n/a
Download CSV