Transcript: Human NR_134667.1

Homo sapiens uridine-cytidine kinase 1 (UCK1), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
UCK1 (83549)
Length:
2163
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134667.1
NBCI Gene record:
UCK1 (83549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037762 CCTCTGGCAAACGGTCACATT pLKO.1 861 3UTR 100% 4.950 6.930 N UCK1 n/a
2 TRCN0000037760 CGGAGCTACAAGCGGACCTTT pLKO.1 809 3UTR 100% 1.650 2.310 N UCK1 n/a
3 TRCN0000199254 CGGTCACATTTGGAGTCCAGC pLKO.1 872 3UTR 100% 0.720 1.008 N UCK1 n/a
4 TRCN0000438847 GGAGGTGCCGACCTATGATTT pLKO_005 403 3UTR 100% 13.200 10.560 N UCK1 n/a
5 TRCN0000037761 CGAGGAGTGGACAATATGGTT pLKO.1 707 3UTR 100% 3.000 2.400 N UCK1 n/a
6 TRCN0000199166 CGTCAGGCTGTCTCGAAGAGT pLKO.1 562 3UTR 100% 1.000 0.800 N UCK1 n/a
7 TRCN0000037759 GCCTTGAAAGGACAGTACAAT pLKO.1 336 3UTR 100% 5.625 3.938 N UCK1 n/a
8 TRCN0000439628 AGTTCTGCCTGCCGACAAAGA pLKO_005 663 3UTR 100% 4.950 3.465 N UCK1 n/a
9 TRCN0000199432 CAAGCCTCCTTTGTGCTATGT pLKO.1 1854 3UTR 100% 4.950 3.465 N UCK1 n/a
10 TRCN0000437455 GCAGTACACCACCTTCGTGAA pLKO_005 628 3UTR 100% 4.050 2.835 N UCK1 n/a
11 TRCN0000037763 CGTGTGTGAGAAGATCATGGA pLKO.1 215 3UTR 100% 2.640 1.584 N UCK1 n/a
12 TRCN0000199086 CCTGCGGACGTGGTTCTGTTT pLKO.1 464 3UTR 100% 1.650 0.990 N UCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488439 TCTACCTGCTAATTGTTTCTTTCG pLX_317 56.4% 26.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491564 AAGCACTAGAATGTAGCCCACATC pLX_317 68.5% 26.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV