Transcript: Human NR_135499.2

Homo sapiens DNA ligase 1 (LIG1), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
LIG1 (3978)
Length:
4038
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135499.2
NBCI Gene record:
LIG1 (3978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431836 ACCGGAAGCAAAGTCAGATTC pLKO_005 3764 3UTR 100% 10.800 15.120 N LIG1 n/a
2 TRCN0000048494 CGGTTTATTCGAGTCCGTGAA pLKO.1 3694 3UTR 100% 4.050 5.670 N LIG1 n/a
3 TRCN0000048493 CCTGCCAAGAACAACTATCAT pLKO.1 873 3UTR 100% 5.625 4.500 N LIG1 n/a
4 TRCN0000439753 GCAGCTTTCACCTGCGAATAC pLKO_005 1752 3UTR 100% 10.800 7.560 N LIG1 n/a
5 TRCN0000048495 GCTCAAGCTGAAGAAGGACTA pLKO.1 2297 3UTR 100% 4.050 2.835 N LIG1 n/a
6 TRCN0000048497 CTGAAACCAATGTTGGCCCAT pLKO.1 1689 3UTR 100% 2.160 1.512 N LIG1 n/a
7 TRCN0000439464 TCCTGGAGCAGTCAGTGAAAG pLKO_005 2200 3UTR 100% 10.800 6.480 N LIG1 n/a
8 TRCN0000165520 GAGGAGGAAGAAGAGGAGAAA pLKO.1 528 3UTR 100% 4.950 2.475 Y AP5B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06523 pDONR223 100% 66.9% None (many diffs) n/a
2 ccsbBroad304_06523 pLX_304 0% 66.9% V5 (many diffs) n/a
3 TRCN0000480678 CGAATTCGAACCGTGTCGTTGAGG pLX_317 14.1% 66.9% V5 (many diffs) n/a
Download CSV