Transcript: Human NR_135617.2

Homo sapiens zinc finger DHHC-type containing 19 (ZDHHC19), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
ZDHHC19 (131540)
Length:
1485
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135617.2
NBCI Gene record:
ZDHHC19 (131540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137344 CAAGTGGGTCAATAACTGCAT pLKO.1 511 3UTR 100% 2.640 3.696 N ZDHHC19 n/a
2 TRCN0000134807 CCAGCAACTGGTATTTAACAA pLKO.1 993 3UTR 100% 5.625 3.938 N ZDHHC19 n/a
3 TRCN0000137220 GCCAGCAACTGGTATTTAACA pLKO.1 992 3UTR 100% 5.625 3.938 N ZDHHC19 n/a
4 TRCN0000134852 CTTACCTTCTTCAGTCTTGTT pLKO.1 296 3UTR 100% 4.950 3.465 N ZDHHC19 n/a
5 TRCN0000138832 GTTATCACAGGCTCCCTCTTT pLKO.1 272 3UTR 100% 4.950 3.465 N ZDHHC19 n/a
6 TRCN0000138599 CTGGCATCTTACATCAAGGCT pLKO.1 336 3UTR 100% 0.750 0.525 N ZDHHC19 n/a
7 TRCN0000138616 CCTTTCCTGTTATCACAGGCT pLKO.1 264 3UTR 100% 0.066 0.046 N ZDHHC19 n/a
8 TRCN0000138529 CCCTCTTTGTCCTTACCTTCT pLKO.1 285 3UTR 100% 4.050 2.430 N ZDHHC19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13160 pDONR223 100% 54.6% None (many diffs) n/a
2 ccsbBroad304_13160 pLX_304 0% 54.6% V5 (many diffs) n/a
Download CSV