Transcript: Human NR_135771.1

Homo sapiens HtrA serine peptidase 2 (HTRA2), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-28
Taxon:
Homo sapiens (human)
Gene:
HTRA2 (27429)
Length:
2002
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135771.1
NBCI Gene record:
HTRA2 (27429)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353041 CATGGTGTACTCATCCATAAA pLKO_005 1219 3UTR 100% 13.200 18.480 N HTRA2 n/a
2 TRCN0000344115 ACGCTGAGGATTCAGACTAAG pLKO_005 745 3UTR 100% 10.800 15.120 N HTRA2 n/a
3 TRCN0000344116 GATCACATCCGGCATTGTTAG pLKO_005 861 3UTR 100% 10.800 15.120 N HTRA2 n/a
4 TRCN0000075206 CCAAACCAATGTGGAATACAT pLKO.1 918 3UTR 100% 5.625 7.875 N HTRA2 n/a
5 TRCN0000344171 AGCACCTGCCGTGGTCTATAT pLKO_005 525 3UTR 100% 13.200 10.560 N HTRA2 n/a
6 TRCN0000352977 CTGATCGTCTTCGAGAGTTTC pLKO_005 1058 3UTR 100% 10.800 8.640 N HTRA2 n/a
7 TRCN0000075207 CCCAAACCAATGTGGAATACA pLKO.1 917 3UTR 100% 5.625 4.500 N HTRA2 n/a
8 TRCN0000075203 GAAGAATCACAGAAACACTTT pLKO.1 1573 3UTR 100% 4.950 3.465 N HTRA2 n/a
9 TRCN0000075205 GCTGAACTACAGCTTCGAGAA pLKO.1 1177 3UTR 100% 4.050 2.835 N HTRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08088 pDONR223 98.5% 55.2% None (many diffs) n/a
2 ccsbBroad304_08088 pLX_304 0% 55.2% V5 (many diffs) n/a
Download CSV