Transcript: Human NR_136188.1

Homo sapiens von Willebrand factor C domain containing 2 (VWC2), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-12-06
Taxon:
Homo sapiens (human)
Gene:
VWC2 (375567)
Length:
2167
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136188.1
NBCI Gene record:
VWC2 (375567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426659 GGCAAGACCTATCAGACTTTG pLKO_005 767 3UTR 100% 10.800 15.120 N VWC2 n/a
2 TRCN0000155745 CGAGACATGAATGCAGGCAAA pLKO.1 1056 3UTR 100% 4.050 5.670 N VWC2 n/a
3 TRCN0000151659 CAACAAGAACTTTGGGCATAA pLKO.1 1267 3UTR 100% 10.800 7.560 N VWC2 n/a
4 TRCN0000431121 TACTGATGTGAACATTCTAGA pLKO_005 1124 3UTR 100% 4.950 3.465 N VWC2 n/a
5 TRCN0000424805 TTGATAACAGTTACTACAACA pLKO_005 1219 3UTR 100% 4.950 3.465 N VWC2 n/a
6 TRCN0000155323 GAGGAAGAACTACTGCGAGTT pLKO.1 742 3UTR 100% 4.050 2.835 N VWC2 n/a
7 TRCN0000155718 CAGAGAAGTGAAGACTGACGA pLKO.1 970 3UTR 100% 2.640 1.848 N VWC2 n/a
8 TRCN0000155935 CCATGTGCACGAGACATGAAT pLKO.1 1047 3UTR 100% 0.563 0.394 N VWC2 n/a
9 TRCN0000151885 CATATGCCACTGTACTTATGA pLKO.1 997 3UTR 100% 0.000 0.000 N VWC2 n/a
10 TRCN0000154815 GCACCATATGCCACTGTACTT pLKO.1 993 3UTR 100% 0.000 0.000 N VWC2 n/a
11 TRCN0000150326 CAGAACACAAACTCTGACTTT pLKO.1 1090 3UTR 100% 4.950 2.970 N VWC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05550 pDONR223 100% 44.9% None 1_103del;1079_2167del n/a
2 ccsbBroad304_05550 pLX_304 0% 44.9% V5 1_103del;1079_2167del n/a
3 TRCN0000477460 CAAGGCACCCCGAGATTTTGCACT pLX_317 45.1% 44.9% V5 1_103del;1079_2167del n/a
Download CSV