Construct: ORF TRCN0000477460
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012606.1_s317c1
- Derived from:
- ccsbBroadEn_05550
- DNA Barcode:
- CAAGGCACCCCGAGATTTTGCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VWC2 (375567)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477460
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 375567 | VWC2 | von Willebrand factor C dom... | NM_198570.5 | 100% | 100% | |
| 2 | human | 375567 | VWC2 | von Willebrand factor C dom... | NR_136188.1 | 44.9% | 1_103del;1079_2167del | |
| 3 | human | 375567 | VWC2 | von Willebrand factor C dom... | XR_001744721.1 | 44.3% | 1_25del;1001_2197del | |
| 4 | human | 375567 | VWC2 | von Willebrand factor C dom... | XR_001744720.1 | 31.9% | 1_25del;1001_3047del | |
| 5 | human | 375567 | VWC2 | von Willebrand factor C dom... | XR_001744723.1 | 17.9% | 1_25del;1001_5421del | |
| 6 | mouse | 319922 | Vwc2 | von Willebrand factor C dom... | NM_177033.3 | 88.4% | 90.7% | (many diffs) |
| 7 | mouse | 319922 | Vwc2 | von Willebrand factor C dom... | XR_380971.2 | 36.9% | (many diffs) | |
| 8 | mouse | 319922 | Vwc2 | von Willebrand factor C dom... | XR_001780018.1 | 20.3% | (many diffs) | |
| 9 | mouse | 319922 | Vwc2 | von Willebrand factor C dom... | XR_380970.2 | 9.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1044
- ORF length:
- 975
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcccagctcc actgcgatgg cagttggcgc gctctccagt tccctcctgg 121 tcacctgctg cctgatggtg gctctgtgca gtccgagcat cccgctggag aagctggccc 181 aggcaccaga gcagccgggc caggagaagc gtgagcacgc ctctcgggac ggcccggggc 241 gggtgaacga gctcgggcgc ccggcgaggg acgagggcgg cagcggccgg gactggaaga 301 gcaagagcgg ccgtgggctc gccggccgtg agccgtggag caagctgaag caggcctggg 361 tctcccaggg cgggggcgcc aaggccgggg atctgcaggt ccggccccgc ggggacaccc 421 cgcaggcgga agccctggcc gcagccgccc aggacgcgat tggcccggaa ctcgcgccca 481 cgcccgagcc acccgaggag tacgtgtacc cggactaccg tggcaagggc tgcgtggacg 541 agagcggctt cgtgtacgcg atcggggaga agttcgcgcc gggcccctcg gcctgcccgt 601 gccTGTGCAC CGAGGAGGGG CCGCTGTGCG CGCAGCCCGA GTGCCCGAGG CTGCACCCGC 661 GCTGCATCCA CGTCGACACG AGCCAGTGCT GCCCGCAGTG CAAGGAGAGG AAGAACTACT 721 GCGAGTTCCG GGGCAAGACC TATCAGACTT TGGAGGAGTT CGTGGTGTCT CCATGCGAGA 781 GGTGTCGCTG TGAAGCCAAC GGTGAGGTGC TATGCACAGT GTCAGCGTGT CCCCAGACGG 841 AGTGTGTGGA CCCTGTGTAC GAGCCTGATC AGTGCTGTCC CATCTGCAAA AATGGTCCAA 901 ACTGCTTTGC AGAAACCGCG GTGATCCCTG CTGGCAGAGA AGTGAAGACT GACGAGTGCA 961 CCATATGCCA CTGTACTTAT GAGGAAGGCA CATGGAGAAT CGAGCGGCAG GCCATGTGCA 1021 CGAGACATGA ATGCAGGCAA ATGTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC AAGGCACCCC 1201 GAGATTTTGC ACTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att