Transcript: Human NR_136227.1

Homo sapiens DEAH-box helicase 8 (DHX8), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-03-12
Taxon:
Homo sapiens (human)
Gene:
DHX8 (1659)
Length:
4128
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136227.1
NBCI Gene record:
DHX8 (1659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433974 ACCATCCCAGGTCGAACATAT pLKO_005 2379 3UTR 100% 13.200 10.560 N DHX8 n/a
2 TRCN0000430329 AGCTCGTGGTGACGCCTATTT pLKO_005 2609 3UTR 100% 13.200 10.560 N DHX8 n/a
3 TRCN0000000025 GACCCAACTAAGCTAAGCAAA pLKO.1 3544 3UTR 100% 4.950 3.960 N DHX8 n/a
4 TRCN0000421309 AGAGACTGGAGAAGATCTAAA pLKO_005 1193 3UTR 100% 13.200 9.240 N DHX8 n/a
5 TRCN0000010513 TGGCTTGACCTCGTGGAAATA pLKO.1 4084 3UTR 100% 13.200 9.240 N DHX8 n/a
6 TRCN0000430619 TCTGGATAGATGGCGGGATAA pLKO_005 908 3UTR 100% 10.800 7.560 N DHX8 n/a
7 TRCN0000000026 AGACAGAGATAGGGAACGAAA pLKO.1 731 3UTR 100% 4.950 3.465 N DHX8 n/a
8 TRCN0000000027 CCACCAATATCGCAGAGACAT pLKO.1 2504 3UTR 100% 4.950 3.465 N DHX8 n/a
9 TRCN0000000028 CCTGCCCATCTACAAACTGAA pLKO.1 1865 3UTR 100% 4.950 3.465 N DHX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10427 pDONR223 100% 80.2% None (many diffs) n/a
2 ccsbBroad304_10427 pLX_304 0% 80.2% V5 (many diffs) n/a
3 TRCN0000480235 AGAATCGTTCCCCGGGAAGTCTCT pLX_317 12.4% 80.2% V5 (many diffs) n/a
Download CSV