Transcript: Human NR_136618.2

Homo sapiens cysteine dioxygenase type 1 (CDO1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CDO1 (1036)
Length:
1885
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136618.2
NBCI Gene record:
CDO1 (1036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136618.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056592 CCAGTACAGGTATACCCGAAA pLKO.1 424 3UTR 100% 4.050 5.670 N CDO1 n/a
2 TRCN0000289559 CCAGTACAGGTATACCCGAAA pLKO_005 424 3UTR 100% 4.050 5.670 N CDO1 n/a
3 TRCN0000056589 GCAGCAGTATTCATGATCATA pLKO.1 507 3UTR 100% 5.625 4.500 N CDO1 n/a
4 TRCN0000306765 GCAGCAGTATTCATGATCATA pLKO_005 507 3UTR 100% 5.625 4.500 N CDO1 n/a
5 TRCN0000056590 CGAGTAGAGAACATCAGCCAT pLKO.1 1003 3UTR 100% 2.640 1.848 N CDO1 n/a
6 TRCN0000056591 GCCATGCCTTTGATCAAAGAA pLKO.1 1073 3UTR 100% 5.625 3.375 N CDO1 n/a
7 TRCN0000289500 GCCATGCCTTTGATCAAAGAA pLKO_005 1073 3UTR 100% 5.625 3.375 N CDO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136618.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05981 pDONR223 100% 31.7% None (many diffs) n/a
2 ccsbBroad304_05981 pLX_304 0% 31.7% V5 (many diffs) n/a
3 TRCN0000466964 TACCGGGCAGGACGAATCGCAGGC pLX_317 79.6% 31.7% V5 (many diffs) n/a
Download CSV