Transcript: Human NR_136749.1

Homo sapiens SHOC2 leucine rich repeat scaffold protein (SHOC2), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
SHOC2 (8036)
Length:
3010
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136749.1
NBCI Gene record:
SHOC2 (8036)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152103 CGTTTCTCTTGAGGTTCTTAT pLKO.1 684 3UTR 100% 13.200 18.480 N SHOC2 n/a
2 TRCN0000151223 GCAGTGCACTTGAAGAATTAA pLKO.1 329 3UTR 100% 15.000 10.500 N SHOC2 n/a
3 TRCN0000154502 GCCTTGGAGAGAACCTACTTA pLKO.1 911 3UTR 100% 5.625 3.938 N SHOC2 n/a
4 TRCN0000151603 GAGAACCTAGAAGAACTGTAT pLKO.1 961 3UTR 100% 4.950 3.465 N SHOC2 n/a
5 TRCN0000153341 GCACATTGCATAGAAGCCATT pLKO.1 2416 3UTR 100% 4.050 2.835 N SHOC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01856 pDONR223 100% 30.3% None (many diffs) n/a
2 ccsbBroad304_01856 pLX_304 0% 30.3% V5 (many diffs) n/a
3 TRCN0000466518 AAGGCACCCCCTATCAGGACCTCT pLX_317 22.5% 30.3% V5 (many diffs) n/a
Download CSV