Transcript: Human NR_137633.2

Homo sapiens selenoprotein I (SELENOI), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
SELENOI (85465)
Length:
7974
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_137633.2
NBCI Gene record:
SELENOI (85465)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_137633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154831 GCAGGCATAGTTTCCACTTTA pLKO.1 4318 3UTR 100% 13.200 18.480 N SELENOI n/a
2 TRCN0000156471 CGCAGAACCAATTCTAGCACT pLKO.1 424 3UTR 100% 2.640 3.696 N SELENOI n/a
3 TRCN0000151614 GCTACATCCTAGAGTATTCTA pLKO.1 856 3UTR 100% 5.625 4.500 N SELENOI n/a
4 TRCN0000158136 CGGCACTAACTCATGGTTCTA pLKO.1 2718 3UTR 100% 4.950 3.960 N SELENOI n/a
5 TRCN0000154952 GCCACAGTTTACAGTGTCATT pLKO.1 3968 3UTR 100% 4.950 3.960 N SELENOI n/a
6 TRCN0000412616 ACCTATTCACTGCAATGATTA pLKO_005 749 3UTR 100% 13.200 9.240 N Selenoi n/a
7 TRCN0000157008 GCCTGAGCTTTGGGAGAATAT pLKO.1 4285 3UTR 100% 13.200 9.240 N SELENOI n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6218 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_137633.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12917 pDONR223 100% 9.7% None 1_90del;865_7974del n/a
2 ccsbBroad304_12917 pLX_304 0% 9.7% V5 1_90del;865_7974del n/a
3 TRCN0000472043 GCGCCACTCATTTACGTGGAATCT pLX_317 62.8% 9.7% V5 1_90del;865_7974del n/a
Download CSV