Transcript: Human NR_138029.2

Homo sapiens pyroglutamyl-peptidase I (PGPEP1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PGPEP1 (54858)
Length:
7162
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138029.2
NBCI Gene record:
PGPEP1 (54858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051979 GACCTGCATGTGTACGAGATT pLKO.1 326 3UTR 100% 4.950 6.930 N PGPEP1 n/a
2 TRCN0000051981 GCCTGAAAGCATTGACTCCAT pLKO.1 541 3UTR 100% 2.640 2.112 N PGPEP1 n/a
3 TRCN0000310851 GGACCTGCATGTGTACGAGAT pLKO_005 325 3UTR 100% 4.050 2.835 N Pgpep1 n/a
4 TRCN0000051978 CCACAGTCACACTGGAGAAAT pLKO.1 444 3UTR 100% 13.200 7.920 N PGPEP1 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1564 3UTR 100% 13.200 6.600 Y LIAS n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2813 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2813 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12097 pDONR223 100% 4.9% None 1_436del;639_640ins40;793_7162del n/a
2 ccsbBroad304_12097 pLX_304 0% 4.9% V5 1_436del;639_640ins40;793_7162del n/a
3 TRCN0000477288 CTTAAATCATCAATGGTCTGTATT pLX_317 98.5% 4.9% V5 1_436del;639_640ins40;793_7162del n/a
Download CSV