Transcript: Human NR_144297.2

Homo sapiens von Willebrand factor A domain containing 3B (VWA3B), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
VWA3B (200403)
Length:
2895
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144297.2
NBCI Gene record:
VWA3B (200403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144297.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242978 ATGTCGTGTCTAAGGTCTTTG pLKO_005 2796 3UTR 100% 10.800 15.120 N VWA3B n/a
2 TRCN0000242979 CAAGACTATTGAATCCATTTA pLKO_005 925 3UTR 100% 13.200 9.240 N VWA3B n/a
3 TRCN0000242977 TGCCGAGAGGCTCTAACAATG pLKO_005 704 3UTR 100% 10.800 7.560 N VWA3B n/a
4 TRCN0000172236 CCAGAGGCTGTTCAGAATGAA pLKO.1 2153 3UTR 100% 5.625 3.938 N VWA3B n/a
5 TRCN0000087239 GACAAGATCATTCAGTTCATA pLKO.1 1730 3UTR 100% 5.625 3.938 N Vwa3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144297.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.